| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.245628 |
| Chromosome: | chromosome 16 |
| Location: | 7421776 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre16.g686173 | (1 of 1) PTHR11071:SF276 - PEPTIDYL-PROLYL CIS-TRANS ISOMERASE | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTGTGGCTACTGTCGCACGTTTGAGCGTTG |
| Internal bar code: | GTTGCACGCGTTCTGTGAGCGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 84 |
| LEAP-Seq percent confirming: | 99.8596 |
| LEAP-Seq n confirming: | 1423 |
| LEAP-Seq n nonconfirming: | 2 |
| LEAP-Seq n unique pos: | 8 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AGGGCACAAGGAAAACATTG |
| Suggested primer 2: | TGCAAGGATGGGTAAAGGAG |