Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | - |
Strain: | LMJ.RY0402.245665 |
Chromosome: | chromosome 9 |
Location: | 4682864 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre09.g396846 | (1 of 2) PTHR22957//PTHR22957:SF148 - TBC1 DOMAIN FAMILY MEMBER GTPASE-ACTIVATING PROTEIN // RE26521P | CDS |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TATTTTGTTGCCTCCGGCGCGCACAAGCTC |
Internal bar code: | CGCTTGCCCACGTCTCAGGCAT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 331 |
LEAP-Seq percent confirming: | 99.1716 |
LEAP-Seq n confirming: | 838 |
LEAP-Seq n nonconfirming: | 7 |
LEAP-Seq n unique pos: | 12 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | TCTGCTATTTGCACCACTCG |
Suggested primer 2: | GGACGTATGCCTTGAGTGGT |