Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | + |
Strain: | LMJ.RY0402.245757 |
Chromosome: | chromosome 3 |
Location: | 5552774 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre03.g186400 | SCR1 | (1 of 3) PF03803 - Scramblase (Scramblase); Putative phospholipid scramblase | CDS |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCGCCGCCCCCATGCGGCAGCAGTCCTCCG |
Internal bar code: | CGTGGGCGCAGGGAGACTAAGA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 601 |
LEAP-Seq percent confirming: | 99.5876 |
LEAP-Seq n confirming: | 966 |
LEAP-Seq n nonconfirming: | 4 |
LEAP-Seq n unique pos: | 14 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CCGGTCAACCAACTTGCTAT |
Suggested primer 2: | AACGGGAATAAACACGTTGC |