Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | - |
Strain: | LMJ.RY0402.245760 |
Chromosome: | chromosome 6 |
Location: | 3162002 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre06.g275450 | (1 of 1) PF00069//PF13855 - Protein kinase domain (Pkinase) // Leucine rich repeat (LRR_8) | CDS |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TAGTGTTTGTGGTTGTTGTGGTATTGGTGT |
Internal bar code: | TGTGGGGAAGTACTTTCTACCT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 588 |
LEAP-Seq percent confirming: | 98.4453 |
LEAP-Seq n confirming: | 1583 |
LEAP-Seq n nonconfirming: | 25 |
LEAP-Seq n unique pos: | 4 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | TCCGCAGTGACACTTTTGAG |
Suggested primer 2: | GGACGGGTGAATGTGGTAGT |