Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | - |
Strain: | LMJ.RY0402.245810 |
Chromosome: | chromosome 4 |
Location: | 1740235 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre04.g212350 | (1 of 2) PF10013 - Uncharacterized protein conserved in bacteria (DUF2256) (DUF2256) | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CATAATAAAGCCCTATGCACAACCTCCATA |
Internal bar code: | ACTGGCTGTTCAGTGGGGGATG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 654 |
LEAP-Seq percent confirming: | 98.7526 |
LEAP-Seq n confirming: | 475 |
LEAP-Seq n nonconfirming: | 6 |
LEAP-Seq n unique pos: | 10 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GCCTCCAGTGATTTCTGCTC |
Suggested primer 2: | GTGCTTACTGCCAAGCATGA |