Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | + |
Strain: | LMJ.RY0402.245971 |
Chromosome: | chromosome 16 |
Location: | 4712992 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre16.g687000 | FPN1 | Ferroportin 1; (1 of 1) K14685 - solute carrier family 40 (iron-regulated transporter), member 1 (SLC40A1, FPN1) | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCCGTGGTGAAACCCCCACCTCGCCCCCTT |
Internal bar code: | AAGGCGTTATACACCTACGCCG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 1145 |
LEAP-Seq percent confirming: | 98.9977 |
LEAP-Seq n confirming: | 2173 |
LEAP-Seq n nonconfirming: | 22 |
LEAP-Seq n unique pos: | 6 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GGCAGCTAGTTGTGCACGTA |
Suggested primer 2: | ACACCCAGGCCTATCCTCTT |