Insertion junction: LMJ.RY0402.245994_1

Overview

Insertion cassette:CIB1
Side of cassette:3'
Strand:+
Strain:LMJ.RY0402.245994
Chromosome:chromosome_13
Location:1619108
Confidence (%):73
Locus disrupted Locus common name Defline Orientation Feature
Cre13.g573500 FAP95 Flagellar Associated Protein sense 3'UTR

Insertion site details

Flanking sequence (orientation from cassette outwards):AATCGATACGTCCATGCCATGCCCAACCAG
Internal bar code:GGTCGTAACGTTTGAGCGATGC

Confirmation - LEAP-Seq

LEAP-Seq distance:325
LEAP-Seq percent confirming:100.0
LEAP-Seq n confirming:113
LEAP-Seq n nonconfirming:0
LEAP-Seq n unique pos:4

Suggested primers for confirmation by PCR

Suggested primer 1:TGCAGATGAGGGTGAGAGTG
Suggested primer 2:ATTTACATCCGCTCCGTGAC