| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.246020 |
| Chromosome: | chromosome 2 |
| Location: | 163740 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre02.g074370 | CDPK8 | Calcium/calmodulin-dependent protein kinase; (1 of 18) K13412 - calcium-dependent protein kinase (CPK) | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCGAGCAAGTCCAACGACACGGCGCGGCCA |
| Internal bar code: | GTGCCAGTAGCGTGGCGGGCCC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 873 |
| LEAP-Seq percent confirming: | 98.8607 |
| LEAP-Seq n confirming: | 2690 |
| LEAP-Seq n nonconfirming: | 31 |
| LEAP-Seq n unique pos: | 8 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GCCACAAACACAGAGCAGAA |
| Suggested primer 2: | GGGTCTTGTAGTCCGACCCT |