| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.246088 |
| Chromosome: | chromosome 9 |
| Location: | 4190347 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre09.g394102 | GUK2 | Guanylate kinase; (1 of 1) 1.1.1.216//2.7.4.8 - Farnesol dehydrogenase // Guanylate kinase / Guanosine monophosphate kinase | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCTCTTCCAACCCGGCGCCAAGGCCCAGCA |
| Internal bar code: | TTTTGGGTACCATTTAGTGAAT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 596 |
| LEAP-Seq percent confirming: | 99.6326 |
| LEAP-Seq n confirming: | 1627 |
| LEAP-Seq n nonconfirming: | 6 |
| LEAP-Seq n unique pos: | 2 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AACCTCGTCCTTCCCAACTT |
| Suggested primer 2: | GCCCCGGGATATATTTCAGT |