| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.246134 |
| Chromosome: | chromosome 1 |
| Location: | 3020389 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre01.g018600 | (1 of 1) PF05529 - B-cell receptor-associated protein 31-like (Bap31) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCTTCACGTCTCCCTAGCCCGGGACATGGA |
| Internal bar code: | CCGCTAGGCCCTAGCACGGGCG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 568 |
| LEAP-Seq percent confirming: | 96.0663 |
| LEAP-Seq n confirming: | 464 |
| LEAP-Seq n nonconfirming: | 19 |
| LEAP-Seq n unique pos: | 8 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TGTTCTTTGGGACAACCTCC |
| Suggested primer 2: | AGAAGTTCCGCTCCTGCATA |