Insertion junction: LMJ.RY0402.246223_1

Overview

Insertion cassette:CIB1
Side of cassette:5'
Strand:-
Strain:LMJ.RY0402.246223
Chromosome:chromosome_1
Location:4779232
Confidence (%):73
Locus disrupted Locus common name Defline Orientation Feature
Cre01.g033000 sense 5'UTR

Insertion site details

Flanking sequence (orientation from cassette outwards):TTGCCACTAACTCCACTCATTTCAGCAACC
Internal bar code:TCGCTATTGAGTATAGTGTTA

Confirmation - LEAP-Seq

LEAP-Seq distance:296
LEAP-Seq percent confirming:99.3045
LEAP-Seq n confirming:2570
LEAP-Seq n nonconfirming:18
LEAP-Seq n unique pos:4

Suggested primers for confirmation by PCR

Suggested primer 1:TCATGAAGTATGACCGCCAA
Suggested primer 2:TTATTGAAGAGGCACGAGGG