| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.246240 |
| Chromosome: | chromosome 14 |
| Location: | 1215868 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre14.g616100 | FKB11,FKB53 | (1 of 1) K14826 - FK506-binding nuclear protein [EC:5.2.1.8] (FPR3_4); Peptidyl-prolyl cis-trans isomerase, FKBP-type | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGGAGCGGCGCGCAATGACGTCGCTGCCAT |
| Internal bar code: | CAGGCGGTCATTGGAACGGAGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 900 |
| LEAP-Seq percent confirming: | 99.2366 |
| LEAP-Seq n confirming: | 1170 |
| LEAP-Seq n nonconfirming: | 9 |
| LEAP-Seq n unique pos: | 12 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GACTGAGTGGTAAGCAGGGC |
| Suggested primer 2: | GAGTGGATGAGAGATGGGGA |