| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.246245 |
| Chromosome: | chromosome 9 |
| Location: | 7316222 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre09.g412880 | HSP70F | Heat shock protein 70F; (1 of 2) PTHR19375:SF173 - CHAPERONE PROTEIN DNAK | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCTCCGTGTTGGGATACGCACACGCACATA |
| Internal bar code: | ATGCGCCTGTCGTTACACCCGA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 645 |
| LEAP-Seq percent confirming: | 99.8408 |
| LEAP-Seq n confirming: | 31366 |
| LEAP-Seq n nonconfirming: | 50 |
| LEAP-Seq n unique pos: | 17 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GGTGGTGGTGGTGGTAAAAC |
| Suggested primer 2: | CACACACACACCTCCTCACC |