| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.246337 |
| Chromosome: | chromosome 12 |
| Location: | 5350838 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g529500 | RRM11 | (1 of 1) 2.1.1.167 - 27S pre-rRNA (guanosine(2922)-2'-O)-methyltransferase; Putative ribosomal RNA methyltransferase | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CAGTTTCTGCTTCTTGCGCGCCTTCGCCTC |
| Internal bar code: | CATCCGATTGAGCGCCCCGACG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 284 |
| LEAP-Seq percent confirming: | 99.2188 |
| LEAP-Seq n confirming: | 127 |
| LEAP-Seq n nonconfirming: | 1 |
| LEAP-Seq n unique pos: | 2 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TCCCTTCTTCTCAACGCACT |
| Suggested primer 2: | CATGATTGCAATTGTTTCGC |