| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.246378 |
| Chromosome: | chromosome 3 |
| Location: | 520828 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre03.g145267 | (1 of 1) 3.5.4.3 - Guanine deaminase / Guanine aminase | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTCTCATCCACTGAGTCCATCACTAACCCG |
| Internal bar code: | ATCCTGTGCTGAGGGCCGGGCC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 678 |
| LEAP-Seq percent confirming: | 73.4843 |
| LEAP-Seq n confirming: | 32591 |
| LEAP-Seq n nonconfirming: | 11760 |
| LEAP-Seq n unique pos: | 172 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CGTTTTCGCGTCAGTTGTTA |
| Suggested primer 2: | GCACTCACTTGAAGAACGCA |