| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.246472 |
| Chromosome: | chromosome 10 |
| Location: | 1353839 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre10.g427850 | (1 of 1) IPR000014//IPR000104//IPR013767 - PAS domain // Antifreeze protein, type I // PAS fold | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCATTCCCTCTTGCACCGACCTCGTGACAA |
| Internal bar code: | TTTTCTCTGGGTGGCTTTGCTG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1078 |
| LEAP-Seq percent confirming: | 44.7368 |
| LEAP-Seq n confirming: | 17 |
| LEAP-Seq n nonconfirming: | 21 |
| LEAP-Seq n unique pos: | 1 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ACAAACGAAGCACAAAACCC |
| Suggested primer 2: | TGCTCAAAGTGTTGGAGTCG |