| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.246563 |
| Chromosome: | chromosome 17 |
| Location: | 3094824 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre17.g721000 | ABCA5 | (1 of 2) PTHR19229//PTHR19229:SF127 - ATP-BINDING CASSETTE TRANSPORTER SUBFAMILY A ABCA // SUBFAMILY NOT NAMED; ABC transporter 5 | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AGTTTCTGAACACGCGCGCGCTGTCACCGC |
| Internal bar code: | CAACGCTGTTTATTAAAAAGAC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 228 |
| LEAP-Seq percent confirming: | 76.9953 |
| LEAP-Seq n confirming: | 164 |
| LEAP-Seq n nonconfirming: | 49 |
| LEAP-Seq n unique pos: | 7 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CGCTTCATCTCAATCTCGC |
| Suggested primer 2: | CAACACTCCTCACCTCCCAC |