| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.246635 |
| Chromosome: | chromosome 1 |
| Location: | 2514278 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre01.g014350 | PRX5 | Peroxiredoxin, type II; (1 of 2) PTHR10430//PTHR10430:SF16 - PEROXIREDOXIN // PEROXIREDOXIN-5, MITOCHONDRIAL | gene_edge/mRNA_edge/3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCCCCTCTTCTTACTCTCCTCCAGTCCTGC |
| Internal bar code: | TTGGCGCAGCAGAACCGGATGT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 413 |
| LEAP-Seq percent confirming: | 98.8764 |
| LEAP-Seq n confirming: | 88 |
| LEAP-Seq n nonconfirming: | 1 |
| LEAP-Seq n unique pos: | 1 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AGGCTTAGGCAGCAAAATCA |
| Suggested primer 2: | TTGAAGGTGATGCAGTCTCG |