Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | + |
Strain: | LMJ.RY0402.246690 |
Chromosome: | chromosome 4 |
Location: | 390935 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre04.g217916 | (1 of 1) IPR001395//IPR005399//IPR020471//IPR023210 - Aldo/keto reductase // Potassium channel, voltage-dependent, beta subunit, KCNAB-related // Aldo/keto reductase subgroup // NADP-dependent oxidoreductase domain | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AACGGCACCTCGCCTGCGTTCCTCGGCGCC |
Internal bar code: | CGGGTATATGTGCAGTCTCGAC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 360 |
LEAP-Seq percent confirming: | 98.8889 |
LEAP-Seq n confirming: | 89 |
LEAP-Seq n nonconfirming: | 1 |
LEAP-Seq n unique pos: | 2 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GCTTCCGATTTGCAGACTTC |
Suggested primer 2: | CATCCTCTCTACCCCCTTCC |