Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | - |
Strain: | LMJ.RY0402.246701 |
Chromosome: | chromosome 3 |
Location: | 6030905 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre03.g191150 | (1 of 1) PTHR23322//PTHR23322:SF6 - FAS-ASSOCIATED PROTEIN // UBX DOMAIN-CONTAINING PROTEIN 7 | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCACGCCCGCAACCCCACACACGCCCGCAC |
Internal bar code: | GCTCGGGCGGCGCCGCAAGCGT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 454 |
LEAP-Seq percent confirming: | 97.093 |
LEAP-Seq n confirming: | 167 |
LEAP-Seq n nonconfirming: | 5 |
LEAP-Seq n unique pos: | 5 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CGAGCTCCTCATCCTCAGTC |
Suggested primer 2: | CGGTCTGTCTGGTCTGTTCA |