Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | - |
Strain: | LMJ.RY0402.246766 |
Chromosome: | chromosome 17 |
Location: | 5761460 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre17.g739250 | FAP402 | (1 of 2) IPR000014//IPR000719//IPR001245//IPR002290//IPR011009//IPR020635//IPR029016 - PAS domain // Protein kinase domain // Serine-threonine/tyrosine-protein kinase catalytic domain // Serine/threonine/dual specificity protein kinase, catalytic domain // Protein kinase-like domain // Tyrosine-protein kinase, catalytic domain // GAF domain-like; Flagellar Associated Protein Kinase 402 | CDS |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTGACGCGGCTGGCCTCGGGAGACACGTCG |
Internal bar code: | ACCCCCTCACGGCCGTACGGTTA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 577 |
LEAP-Seq percent confirming: | 98.668 |
LEAP-Seq n confirming: | 1926 |
LEAP-Seq n nonconfirming: | 26 |
LEAP-Seq n unique pos: | 43 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | AATTTTCCAACCCACCAACA |
Suggested primer 2: | GAAGGACAAGCTGATCGAGG |