| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.246817 |
| Chromosome: | chromosome 13 |
| Location: | 1347684 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre13.g571500 | CST2 | Chlamydomonas-specific membrane transporter of unknown function | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCCTGACCTTACGGTACCCCTGCTGCGCCT |
| Internal bar code: | AAATGAGGTTGAGCATCGCCCC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 577 |
| LEAP-Seq percent confirming: | 95.339 |
| LEAP-Seq n confirming: | 225 |
| LEAP-Seq n nonconfirming: | 11 |
| LEAP-Seq n unique pos: | 8 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GCGCTGACATGATCTGTGTT |
| Suggested primer 2: | GCTAGCGCGGTAGTTTCATC |