| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.246820 |
| Chromosome: | chromosome 7 |
| Location: | 397914 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre07.g314900 | HEL34 | (1 of 1) PTHR24031:SF301 - ATP-DEPENDENT RNA HELICASE DDX18; DEAD/DEAH box helicase | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TAATGCTTCTGCTCGGTCATACGCCAGGTC |
| Internal bar code: | TGGCGATCCCGGGCCGAAGTTG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 217 |
| LEAP-Seq percent confirming: | 99.8137 |
| LEAP-Seq n confirming: | 4286 |
| LEAP-Seq n nonconfirming: | 8 |
| LEAP-Seq n unique pos: | 3 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CTACAACAGCCACAGCCTGA |
| Suggested primer 2: | GCTATGGGAGACATGCGTTT |