| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.246894 |
| Chromosome: | chromosome 4 |
| Location: | 3800132 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre04.g229650 | ADH10 | Alcohol dehydrogenase; (1 of 1) 1.3.1.103 - 2-haloacrylate reductase | 3'UTR|outside_mRNA |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGGATACGGAACTTTTCAAGAGGGGCGGGT |
| Internal bar code: | TTTGGTTTCCGTGTTTTTGGTC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 768 |
| LEAP-Seq percent confirming: | 95.9732 |
| LEAP-Seq n confirming: | 143 |
| LEAP-Seq n nonconfirming: | 6 |
| LEAP-Seq n unique pos: | 2 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CAACCTTGAAAATGCCCAGT |
| Suggested primer 2: | GTTCGTGCGGGTAAGTGTTT |