Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | - |
Strain: | LMJ.RY0402.247271 |
Chromosome: | chromosome 10 |
Location: | 906626 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre10.g424300 | KIN16A,KIN12-2,KIN16-1 | (1 of 32) 3.6.4.4 - Plus-end-directed kinesin ATPase / Kinesin; Kinesin motor protein | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ACCAATCCCAAAGAAACTGAGACGCAGAAC |
Internal bar code: | ATAAAGCGTCGCAGGGTGGCA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 408 |
LEAP-Seq percent confirming: | 99.8062 |
LEAP-Seq n confirming: | 515 |
LEAP-Seq n nonconfirming: | 1 |
LEAP-Seq n unique pos: | 2 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CCTGGGTCTCGGTAAGTTCA |
Suggested primer 2: | TCCTGACCCTGACTTCCAAC |