Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | + |
Strain: | LMJ.RY0402.247478 |
Chromosome: | chromosome 5 |
Location: | 1853147 |
Confidence (%): | 58 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre05.g241851 | (1 of 39) PTHR13078:SF53 - PROTEIN MAOC-1 | CDS|outside_mRNA |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGTCAATGGTGGCGTTGCATACGAAGTTGT |
Internal bar code: | GGACGGACGAATCAGTCGAGGGA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 5 |
LEAP-Seq percent confirming: | 93.3333 |
LEAP-Seq n confirming: | 14 |
LEAP-Seq n nonconfirming: | 1 |
LEAP-Seq n unique pos: | 2 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CATGTAATGACGCCATCGAG |
Suggested primer 2: | GTTAAACTGCGTCTCGCCTC |