Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | - |
Strain: | LMJ.RY0402.247721 |
Chromosome: | chromosome 11 |
Location: | 3507960 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre11.g481350 | (1 of 14) PF14295 - PAN domain (PAN_4) | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTGATATCGAGGAACCCCCTATCACCCCGA |
Internal bar code: | AGGTTATTAAATGAGGTATTGA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 42 |
LEAP-Seq percent confirming: | 99.1701 |
LEAP-Seq n confirming: | 239 |
LEAP-Seq n nonconfirming: | 2 |
LEAP-Seq n unique pos: | 1 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CTAACCCCTGCTGCAGAGAC |
Suggested primer 2: | CGACATCGTACTCACGCACT |