| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.247838 |
| Chromosome: | chromosome 3 |
| Location: | 2393218 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre03.g158950 | (1 of 1) K12833 - pre-mRNA branch site protein p14 (SF3B14) | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTTTAATGCACTGCGCGGTCAACAGTCGGC |
| Internal bar code: | ACTCGACCCCAGCGAAGGATTT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 32 |
| LEAP-Seq percent confirming: | 99.6154 |
| LEAP-Seq n confirming: | 1554 |
| LEAP-Seq n nonconfirming: | 6 |
| LEAP-Seq n unique pos: | 3 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GAAGTGGTGTCGTGGTGATG |
| Suggested primer 2: | GGCTTATTGTGAGCTAGCCG |