| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.247855 |
| Chromosome: | chromosome 3 |
| Location: | 4043748 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre03.g172350 | (1 of 1) PF14736 - Protein N-terminal asparagine amidohydrolase (N_Asn_amidohyd) | 3'UTR_intron | |
| Cre03.g172376 | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGGGGGCTAGCAGGGCTGGCTGTTCGGGGT |
| Internal bar code: | CTTTAATATCAACTCGTTTAAG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 0 |
| LEAP-Seq percent confirming: | 99.4097 |
| LEAP-Seq n confirming: | 842 |
| LEAP-Seq n nonconfirming: | 5 |
| LEAP-Seq n unique pos: | 1 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CAGCAAATGCTGCTTACCAA |
| Suggested primer 2: | TTTTGCATGTGCTCGAAGTC |