| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.247985 |
| Chromosome: | chromosome 10 |
| Location: | 1904741 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre10.g431900 | (1 of 78) IPR002110//IPR020683 - Ankyrin repeat // Ankyrin repeat-containing domain | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTCTTATGCGTAGATATGTCTCGTTGTGGG |
| Internal bar code: | GCACATCCCGCTTGTTGCGTCC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 527 |
| LEAP-Seq percent confirming: | 98.574 |
| LEAP-Seq n confirming: | 553 |
| LEAP-Seq n nonconfirming: | 8 |
| LEAP-Seq n unique pos: | 18 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CCCAACAAGAGCAAGGTGAT |
| Suggested primer 2: | CGTAACACCCCTCATCTCGT |