Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | - |
Strain: | LMJ.RY0402.248087 |
Chromosome: | chromosome 9 |
Location: | 3717833 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre09.g390986 | TSD1 | (1 of 1) PTHR22594//PTHR22594:SF5 - ASPARTYL/LYSYL-TRNA SYNTHETASE // ASPARTATE--TRNA LIGASE, MITOCHONDRIAL; Putative organellar aspartyl-tRNA synthetase | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCCGCAACGCACGTCGTGCTAGATGCCCAT |
Internal bar code: | TACGAGATCTAACCTGAATCGA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 822 |
LEAP-Seq percent confirming: | 99.1111 |
LEAP-Seq n confirming: | 1561 |
LEAP-Seq n nonconfirming: | 14 |
LEAP-Seq n unique pos: | 23 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | TTAACGCAAACCCAAGAACC |
Suggested primer 2: | GCAACAGGCAGGTATTTGGT |