| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.248216 |
| Chromosome: | chromosome 12 |
| Location: | 1550886 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g486900 | (1 of 1) 1.3.1.88 - tRNA-dihydrouridine(16/17) synthase (NAD(P)(+)) / tRNA-dihydrouridine synthase 1 | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCGTTCCATGGCGAGGCAGGGTACCGGGCA |
| Internal bar code: | CAGCCTTCTGCGTATGGCTTCA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 649 |
| LEAP-Seq percent confirming: | 84.3912 |
| LEAP-Seq n confirming: | 1303 |
| LEAP-Seq n nonconfirming: | 241 |
| LEAP-Seq n unique pos: | 32 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AGTGAAGGGGAAGGGAGGTA |
| Suggested primer 2: | GAGGAAGGGGAAGTCGTTTC |