| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.248218 |
| Chromosome: | chromosome 7 |
| Location: | 2967026 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre07.g333000 | CEP4 | (1 of 1) 3.4.22.15 - Cathepsin L; Cysteine endopeptidase | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCACAAGGCGCGCCGGGAAATGCATTGTCA |
| Internal bar code: | AGACTGCGACTTTGTCCGCAAC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 702 |
| LEAP-Seq percent confirming: | 98.3793 |
| LEAP-Seq n confirming: | 607 |
| LEAP-Seq n nonconfirming: | 10 |
| LEAP-Seq n unique pos: | 21 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TATACCAGCAGCAGCACCAG |
| Suggested primer 2: | TGACGTACGTACCCAAACGA |