Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | - |
Strain: | LMJ.RY0402.248235 |
Chromosome: | chromosome 17 |
Location: | 1535476 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre17.g707300 | PGA3 | Phospholipid/glycerol acyltransferase; (1 of 1) PTHR23063:SF1 - 1-ACYLGLYCEROPHOSPHOCHOLINE O-ACYLTRANSFERASE 1 | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AGGGAACGACGTCAGGGTAGGACCCACTCT |
Internal bar code: | ACTGACTATCACTCCGAACGTG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 205 |
LEAP-Seq percent confirming: | 99.4714 |
LEAP-Seq n confirming: | 2258 |
LEAP-Seq n nonconfirming: | 12 |
LEAP-Seq n unique pos: | 1 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | ACTGTACCTGATTCCGCCAC |
Suggested primer 2: | CCTCCACTCTCTCAACTCCG |