| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.248247 |
| Chromosome: | chromosome 16 |
| Location: | 2885532 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre16.g663600 | PHT7,PHT4-7,PHT4G | Sodium-dependent phosphate transporter, major facilitator superfamily; (1 of 4) K08193 - MFS transporter, ACS family, solute carrier family 17 (sodium-dependent inorganic phosphate cotransporter), other (SLC17A) | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTCAAAAAGGCGTGCCCGTACGGCACAACC |
| Internal bar code: | CTGGCGGTCGCCGTCTCGTAAC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 680 |
| LEAP-Seq percent confirming: | 93.6225 |
| LEAP-Seq n confirming: | 2892 |
| LEAP-Seq n nonconfirming: | 197 |
| LEAP-Seq n unique pos: | 63 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ATGAGAATTTGCTCGATGGG |
| Suggested primer 2: | TGTTTGTTGGGAAAGCACAA |