Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | - |
Strain: | LMJ.RY0402.248348 |
Chromosome: | chromosome 3 |
Location: | 8685966 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre03.g203793 | GT90-35,GT90F35 | (1 of 52) PF05686 - Glycosyl transferase family 90 (Glyco_transf_90); GT90 family protein 35 | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGGGCAGGAGGAGGAGGAGAGTGGCGGTCA |
Internal bar code: | GCCCTTCGACTCAACCCCACCG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 2005 |
LEAP-Seq percent confirming: | 54.7892 |
LEAP-Seq n confirming: | 2105 |
LEAP-Seq n nonconfirming: | 1737 |
LEAP-Seq n unique pos: | 53 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CAGAGGTGGGGAGGTGTATG |
Suggested primer 2: | GCCCTACACAAACACACACG |