Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | + |
Strain: | LMJ.RY0402.248352 |
Chromosome: | chromosome 6 |
Location: | 180202 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre06.g250300 | DHC16,DHC1b,FLA24 | (1 of 1) K10414 - dynein heavy chain 2, cytosolic (DYNC2H, DNCH2); Cytoplasmic Dynein 1b Heavy Chain | CDS |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCTTGGAGAGCACGACCTGTTCGAGGGCAC |
Internal bar code: | ATGATGCGTGGACATCAACAAT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 648 |
LEAP-Seq percent confirming: | 98.8764 |
LEAP-Seq n confirming: | 2200 |
LEAP-Seq n nonconfirming: | 25 |
LEAP-Seq n unique pos: | 62 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CCTGACACCCCTTATCCTGA |
Suggested primer 2: | GTTCATTAAAGCTGCTCGGC |