| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.248352 |
| Chromosome: | chromosome 6 |
| Location: | 180202 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre06.g250300 | DHC16,DHC1b,FLA24 | (1 of 1) K10414 - dynein heavy chain 2, cytosolic (DYNC2H, DNCH2); Cytoplasmic Dynein 1b Heavy Chain | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCTTGGAGAGCACGACCTGTTCGAGGGCAC |
| Internal bar code: | ATGATGCGTGGACATCAACAAT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 648 |
| LEAP-Seq percent confirming: | 98.8764 |
| LEAP-Seq n confirming: | 2200 |
| LEAP-Seq n nonconfirming: | 25 |
| LEAP-Seq n unique pos: | 62 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CCTGACACCCCTTATCCTGA |
| Suggested primer 2: | GTTCATTAAAGCTGCTCGGC |