| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.248385 |
| Chromosome: | chromosome 2 |
| Location: | 1807811 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre02.g086887 | NUP98-96,NUP189 | Nucleoporin 98-96; (1 of 1) K14297 - nuclear pore complex protein Nup98-Nup96 (NUP98, ADAR2, NUP116) | 3'UTR|outside_mRNA |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GAATGGCATGGAGGGCGCTAACAGGTTCAG |
| Internal bar code: | CCTGATCATGGTCGTGCCGCAG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 480 |
| LEAP-Seq percent confirming: | 95.3202 |
| LEAP-Seq n confirming: | 387 |
| LEAP-Seq n nonconfirming: | 19 |
| LEAP-Seq n unique pos: | 20 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AGCTTGAGGCGTGGTCTTT |
| Suggested primer 2: | TTTGATTTTCAGAAACCCGC |