| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.248505 |
| Chromosome: | chromosome 16 |
| Location: | 1136293 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre16.g650151 | SPAST1 | (1 of 2) PF05496//PF09336 - Holliday junction DNA helicase ruvB N-terminus (RuvB_N) // Vps4 C terminal oligomerisation domain (Vps4_C); Spastin homologue | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCTCTCCCATGCCCCTTTGGCACATGCACC |
| Internal bar code: | AATACGCCACGGGGGATAACCG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 391 |
| LEAP-Seq percent confirming: | 99.0649 |
| LEAP-Seq n confirming: | 1801 |
| LEAP-Seq n nonconfirming: | 17 |
| LEAP-Seq n unique pos: | 13 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AACACAGGTTGAGGATTCCG |
| Suggested primer 2: | TTTGCGGCTAACTAACCCAC |