Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | + |
Strain: | LMJ.RY0402.248505 |
Chromosome: | chromosome 16 |
Location: | 1136293 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre16.g650151 | SPAST1 | (1 of 2) PF05496//PF09336 - Holliday junction DNA helicase ruvB N-terminus (RuvB_N) // Vps4 C terminal oligomerisation domain (Vps4_C); Spastin homologue | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCTCTCCCATGCCCCTTTGGCACATGCACC |
Internal bar code: | AATACGCCACGGGGGATAACCG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 391 |
LEAP-Seq percent confirming: | 99.0649 |
LEAP-Seq n confirming: | 1801 |
LEAP-Seq n nonconfirming: | 17 |
LEAP-Seq n unique pos: | 13 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | AACACAGGTTGAGGATTCCG |
Suggested primer 2: | TTTGCGGCTAACTAACCCAC |