Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | + |
Strain: | LMJ.RY0402.248573 |
Chromosome: | chromosome 12 |
Location: | 2526835 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre12.g506000 | IC69,ODA6,ODA-IC2,DIC2,IC70,IC2 | (1 of 1) K11143 - dynein intermediate chain 2, axonemal (DNAI2); Flagellar Outer Arm Dynein Intermediate Chain 2 | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTGACTGTTAGGCATGGCGTGTCTAGACCA |
Internal bar code: | TCTGCCCCTACGGGCGGGGGGC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 643 |
LEAP-Seq percent confirming: | 98.892 |
LEAP-Seq n confirming: | 714 |
LEAP-Seq n nonconfirming: | 8 |
LEAP-Seq n unique pos: | 36 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | TCAAGTACGTGCTCAGTGGC |
Suggested primer 2: | ATGGGACAGTGGTAAGGCAG |