| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.248681 |
| Chromosome: | chromosome 3 |
| Location: | 4264659 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre03.g174400 | CDO1 | Cysteine dioxygenase, regulated by copper nutrition; (1 of 2) 1.13.11.20 - Cysteine dioxygenase | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCCCTTCGTGGGAAGGGCACAGCGGTGTCA |
| Internal bar code: | GGCAGCTGATATGTTCGGTTCA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 215 |
| LEAP-Seq percent confirming: | 99.7085 |
| LEAP-Seq n confirming: | 342 |
| LEAP-Seq n nonconfirming: | 1 |
| LEAP-Seq n unique pos: | 3 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ATGCTGCACCACCAACAATA |
| Suggested primer 2: | CCCACCTGGAAGGAGTTGTA |