| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.248788 |
| Chromosome: | chromosome 14 |
| Location: | 2657947 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre14.g626400 | CYP33,CYP743C1 | (1 of 3) 1.14.14.1//5.3.99.5 - Unspecific monooxygenase / Xenobiotic monooxygenase // Thromboxane-A synthase / Thromboxane synthetase; Cytochrome P450, CYP197 superfamily | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTTGGTCTCGGTGTGTTGTTGGTCATCTGG |
| Internal bar code: | GACTAGGTTGTGCGACTCTTC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 476 |
| LEAP-Seq percent confirming: | 83.75 |
| LEAP-Seq n confirming: | 134 |
| LEAP-Seq n nonconfirming: | 26 |
| LEAP-Seq n unique pos: | 8 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TTCAAGTTCGTGTTTGCGAG |
| Suggested primer 2: | CATCTCGCTCATCACCTCAA |