| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.248863 |
| Chromosome: | chromosome 12 |
| Location: | 1037442 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g491150 | VPS55 | (1 of 1) PF04133 - Vacuolar protein sorting 55 (Vps55); Vacuolar trafficking protein | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AGTTGCTGCCAATGGTCGTGCATGCGCCGA |
| Internal bar code: | GGGAAGTAACGCACGAGGGAAC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 584 |
| LEAP-Seq percent confirming: | 97.3747 |
| LEAP-Seq n confirming: | 408 |
| LEAP-Seq n nonconfirming: | 11 |
| LEAP-Seq n unique pos: | 17 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GCAGCAGAGGGTTATTAGCG |
| Suggested primer 2: | CACGTAAGACCCTTGGGAAA |