Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | - |
Strain: | LMJ.RY0402.248929 |
Chromosome: | chromosome 9 |
Location: | 3176998 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre09.g387245 | STT3A | Staurosporin and temperature sensitive 3-like A; (1 of 1) PTHR13872//PTHR13872:SF1 - 60S RIBOSOMAL PROTEIN L35 // DOLICHYL-DIPHOSPHOOLIGOSACCHARIDE--PROTEIN GLYCOSYLTRANSFERASE SUBUNIT STT3B | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TAATCATGAATGTAACCCCCCTACCCCGCC |
Internal bar code: | TAAGGAGTTTCTGCCGGACGGC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 286 |
LEAP-Seq percent confirming: | 8.33333 |
LEAP-Seq n confirming: | 1 |
LEAP-Seq n nonconfirming: | 11 |
LEAP-Seq n unique pos: | 1 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CCTGGTCAGATCCGTCTCAT |
Suggested primer 2: | GTAAGAGGGGATGAGGAGGG |