| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.248960 |
| Chromosome: | chromosome 11 |
| Location: | 2449038 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre11.g475400 | (1 of 1) K11864 - BRCA1/BRCA2-containing complex subunit 3 (BRCC3) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCGAAGCCGGGGTCCGTTGCCGGGAACGGG |
| Internal bar code: | GTTGGTAATTCCAATTGCAACT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 534 |
| LEAP-Seq percent confirming: | 97.1091 |
| LEAP-Seq n confirming: | 739 |
| LEAP-Seq n nonconfirming: | 22 |
| LEAP-Seq n unique pos: | 41 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ACCCCAGTAAGGGCGTCTAT |
| Suggested primer 2: | CTTCAACCCACAATGACACG |