| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.248984 |
| Chromosome: | chromosome 6 |
| Location: | 6097339 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre06.g289850 | SBE1 | (1 of 3) 2.4.1.18 - 1,4-alpha-glucan branching enzyme / Glycogen branching enzyme; Starch Branching Enzyme 1 | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTTCCTGCAGGTGTGTGCCGTGCGTGCGGT |
| Internal bar code: | CTACGCCGCCCATAGCTTTACC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 301 |
| LEAP-Seq percent confirming: | 99.5489 |
| LEAP-Seq n confirming: | 12359 |
| LEAP-Seq n nonconfirming: | 56 |
| LEAP-Seq n unique pos: | 4 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TTACACGAGCAACAGGCAAC |
| Suggested primer 2: | AGGTTGCCTGCATACCTCAC |