Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | - |
Strain: | LMJ.RY0402.249018 |
Chromosome: | chromosome 6 |
Location: | 7655047 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre06.g301550 | MFT18 | Major facilitator superfamily transporter; (1 of 3) PTHR23505//PTHR23505:SF21 - FAMILY NOT NAMED // SPHINGOLIPID TRANSPORTER SPINSTER HOMOLOG 1-RELATED | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ACTCCACACCAAAGCTATTGCGCACATAAC |
Internal bar code: | CGGGACGCGTTGCACACTGATG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 804 |
LEAP-Seq percent confirming: | 98.6532 |
LEAP-Seq n confirming: | 293 |
LEAP-Seq n nonconfirming: | 4 |
LEAP-Seq n unique pos: | 10 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CTGTGTATCCCTGTGGGCTT |
Suggested primer 2: | CAGCCCCTCAGTCTCTGAAC |