| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.249187 |
| Chromosome: | chromosome 17 |
| Location: | 4884461 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre17.g734300 | AGI1 | (1 of 2) PTHR10903//PTHR10903:SF47 - GTPASE, IMAP FAMILY MEMBER-RELATED // TRANSLOCASE OF CHLOROPLAST 120, CHLOROPLASTIC-RELATED; Putative Avirulence-Induced Gene AGI1 | 5'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AAAAGATTGTGGAACATTAGGAGAGGTTGT |
| Internal bar code: | GGACTGTGCAACGCGATCGGTC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 507 |
| LEAP-Seq percent confirming: | 94.1176 |
| LEAP-Seq n confirming: | 16 |
| LEAP-Seq n nonconfirming: | 1 |
| LEAP-Seq n unique pos: | 3 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GCGAGGGGGTAGTTTAGGTC |
| Suggested primer 2: | GTCTAGGCGGTCAGGATACG |