| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.249266 |
| Chromosome: | chromosome 6 |
| Location: | 8500210 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre06.g307800 | CYN49 | (1 of 1) IPR003609//IPR029000 - PAN/Apple domain // Cyclophilin-like domain; Cyclophilin 49 | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCTCTGCCGAGGACTTCAAATGCTGCCAGT |
| Internal bar code: | TTAATGGGCCGTCATGCTCCGC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 367 |
| LEAP-Seq percent confirming: | 99.3718 |
| LEAP-Seq n confirming: | 1740 |
| LEAP-Seq n nonconfirming: | 11 |
| LEAP-Seq n unique pos: | 3 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ATCGTTCTCAATTTGTCCGC |
| Suggested primer 2: | ACTTTGGCATACAGGGCATC |