Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | - |
Strain: | LMJ.RY0402.249369 |
Chromosome: | chromosome 2 |
Location: | 1478137 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre02.g083900 | EXN5 | (1 of 1) PTHR13620:SF15 - EXONUCLEASE MUT-7 HOMOLOG-RELATED; 3'-5' exonuclease | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGGACAAGGCAGGCGAGGCTGCAGTGGGCC |
Internal bar code: | AGGGGTATCAGAACGAAAATGA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 510 |
LEAP-Seq percent confirming: | 99.3852 |
LEAP-Seq n confirming: | 485 |
LEAP-Seq n nonconfirming: | 3 |
LEAP-Seq n unique pos: | 14 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | TACTGCCTTACGAGCCCACT |
Suggested primer 2: | TCACGGCATTGCAGTATCAT |